ID: 1147101191_1147101205

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1147101191 1147101205
Species Human (GRCh38) Human (GRCh38)
Location 17:38182338-38182360 17:38182383-38182405
Sequence CCCACAGGGTAGGTGTCTTCCCG GTGGAAGAACGAGGTGCCCGTGG
Strand - +
Off-target summary {0: 14, 1: 1, 2: 0, 3: 6, 4: 91} {0: 14, 1: 0, 2: 1, 3: 10, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!