ID: 1147139298_1147139310

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1147139298 1147139310
Species Human (GRCh38) Human (GRCh38)
Location 17:38452439-38452461 17:38452490-38452512
Sequence CCTTATGACGCTTCCTCCTGGAC CTGGAGCTGCCCCGCTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70} {0: 1, 1: 0, 2: 1, 3: 20, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!