ID: 1147144811_1147144826

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1147144811 1147144826
Species Human (GRCh38) Human (GRCh38)
Location 17:38478831-38478853 17:38478881-38478903
Sequence CCACACAAAGTCATGTGGGCGTC CAGTGGGCCTGGGCCTGCTGTGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 0, 3: 2, 4: 60} {0: 1, 1: 4, 2: 6, 3: 71, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!