ID: 1147144881_1147144889

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1147144881 1147144889
Species Human (GRCh38) Human (GRCh38)
Location 17:38479111-38479133 17:38479138-38479160
Sequence CCTCCTGGGGCACCTCCTCCATG CTCAGTGTCTGCCAGGACGGTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 2, 3: 42, 4: 404} {0: 1, 1: 0, 2: 0, 3: 13, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!