ID: 1147147166_1147147175

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1147147166 1147147175
Species Human (GRCh38) Human (GRCh38)
Location 17:38491940-38491962 17:38491964-38491986
Sequence CCCCGGCTCTAGTGACTTTCCCT CTGGCCCCACTGAGGTTTTGGGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 1, 3: 35, 4: 629} {0: 5, 1: 0, 2: 3, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!