ID: 1147150432_1147150436

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1147150432 1147150436
Species Human (GRCh38) Human (GRCh38)
Location 17:38510830-38510852 17:38510843-38510865
Sequence CCGGACTCAGCAGCCTGGAGTCC CCTGGAGTCCACCAAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 302} {0: 1, 1: 0, 2: 0, 3: 10, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!