ID: 1147153314_1147153324

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147153314 1147153324
Species Human (GRCh38) Human (GRCh38)
Location 17:38530996-38531018 17:38531029-38531051
Sequence CCAAAGAGAAAGAAAGATGCAAA CTTCACCCGAGCGGGTGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 5, 3: 111, 4: 1003} {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!