ID: 1147158442_1147158448

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1147158442 1147158448
Species Human (GRCh38) Human (GRCh38)
Location 17:38557310-38557332 17:38557344-38557366
Sequence CCCCTTGTTGAAAAGAGAGGTGA CTGGGTACAGATGAGGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180} {0: 1, 1: 0, 2: 3, 3: 37, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!