ID: 1147159490_1147159496

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1147159490 1147159496
Species Human (GRCh38) Human (GRCh38)
Location 17:38562050-38562072 17:38562068-38562090
Sequence CCGCTCCAGGATGGCGCTGGGGC GGGGCTGGGGCTGACGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 29, 4: 263} {0: 1, 1: 0, 2: 4, 3: 68, 4: 538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!