ID: 1147161156_1147161159

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1147161156 1147161159
Species Human (GRCh38) Human (GRCh38)
Location 17:38570058-38570080 17:38570098-38570120
Sequence CCCCGCAACACACAGGCTCACGC CTCAGACACATCCTCTGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 175} {0: 1, 1: 0, 2: 0, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!