ID: 1147166072_1147166087

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1147166072 1147166087
Species Human (GRCh38) Human (GRCh38)
Location 17:38594111-38594133 17:38594149-38594171
Sequence CCCCTGAGCCCACCCTGCAGGCT TGCTGTTTGTGCAGGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 634} {0: 1, 1: 0, 2: 0, 3: 17, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!