ID: 1147166076_1147166087

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1147166076 1147166087
Species Human (GRCh38) Human (GRCh38)
Location 17:38594120-38594142 17:38594149-38594171
Sequence CCACCCTGCAGGCTGAGCCTTGG TGCTGTTTGTGCAGGGAAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 345} {0: 1, 1: 0, 2: 0, 3: 17, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!