ID: 1147183754_1147183762

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1147183754 1147183762
Species Human (GRCh38) Human (GRCh38)
Location 17:38702912-38702934 17:38702926-38702948
Sequence CCCGCCACGAATCCAGCCCAGCC AGCCCAGCCCGCGGGGCACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 359} {0: 1, 1: 0, 2: 3, 3: 18, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!