ID: 1147184498_1147184510

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147184498 1147184510
Species Human (GRCh38) Human (GRCh38)
Location 17:38705907-38705929 17:38705956-38705978
Sequence CCGGGTCAGGCATTGTTTTCTTG ACCCTAAGTTGAGGGAGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 249} {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!