ID: 1147190185_1147190191

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147190185 1147190191
Species Human (GRCh38) Human (GRCh38)
Location 17:38733876-38733898 17:38733925-38733947
Sequence CCCCAAAGAACTACAGGCTCCAG CAAGAGATACAGATGTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182} {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!