ID: 1147200634_1147200652

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1147200634 1147200652
Species Human (GRCh38) Human (GRCh38)
Location 17:38799391-38799413 17:38799438-38799460
Sequence CCACCGCCGTGGTGCTGGTGCAG GCGGCGGCGGCGAAAGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148} {0: 1, 1: 1, 2: 5, 3: 57, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!