|
Left Crispr |
Right Crispr |
| Crispr ID |
1147201353 |
1147201361 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:38803992-38804014
|
17:38804023-38804045
|
| Sequence |
CCATGATCGCCCCACTGCACTCC |
CAACAGAGTGAGACCTTGTAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 1340, 2: 45516, 3: 140407, 4: 169567} |
{0: 1, 1: 4, 2: 39, 3: 133, 4: 521} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|