|
Left Crispr |
Right Crispr |
| Crispr ID |
1147201355 |
1147201361 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:38804001-38804023
|
17:38804023-38804045
|
| Sequence |
CCCCACTGCACTCCAACCTAGGC |
CAACAGAGTGAGACCTTGTAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 106, 2: 1582, 3: 2829, 4: 2768} |
{0: 1, 1: 4, 2: 39, 3: 133, 4: 521} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|