ID: 1147201356_1147201361

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1147201356 1147201361
Species Human (GRCh38) Human (GRCh38)
Location 17:38804002-38804024 17:38804023-38804045
Sequence CCCACTGCACTCCAACCTAGGCA CAACAGAGTGAGACCTTGTAGGG
Strand - +
Off-target summary {0: 3, 1: 82, 2: 1181, 3: 2622, 4: 3719} {0: 1, 1: 4, 2: 39, 3: 133, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!