ID: 1147202835_1147202843

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1147202835 1147202843
Species Human (GRCh38) Human (GRCh38)
Location 17:38814972-38814994 17:38815009-38815031
Sequence CCTGCCTCCTTCTCCTCCATCTT TGTCAATGGGGCGCCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 330, 4: 2086} {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!