ID: 1147209879_1147209887

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1147209879 1147209887
Species Human (GRCh38) Human (GRCh38)
Location 17:38866751-38866773 17:38866793-38866815
Sequence CCTGCCCCCATCTCCACAAAATG AACAAAAATTGAACCAAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 147, 4: 2253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!