ID: 1147232730_1147232738

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1147232730 1147232738
Species Human (GRCh38) Human (GRCh38)
Location 17:39030860-39030882 17:39030907-39030929
Sequence CCAATAGCAGGCCAGGACCAAGC CACATTTCAACCTTTAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109} {0: 1, 1: 0, 2: 13, 3: 24, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!