ID: 1147232816_1147232821

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1147232816 1147232821
Species Human (GRCh38) Human (GRCh38)
Location 17:39031434-39031456 17:39031452-39031474
Sequence CCAATGTCACCCAGCGTTACAGC ACAGCTCAACCTTTGGACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 5, 4: 93} {0: 1, 1: 11, 2: 16, 3: 14, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!