ID: 1147253472_1147253479

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1147253472 1147253479
Species Human (GRCh38) Human (GRCh38)
Location 17:39167192-39167214 17:39167212-39167234
Sequence CCAGCCACATGGGGCTTCTCCCT CCTACACTGGGCTTATAGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 306} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!