ID: 1147262583_1147262593

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1147262583 1147262593
Species Human (GRCh38) Human (GRCh38)
Location 17:39217289-39217311 17:39217310-39217332
Sequence CCCAGCACCTACCCCTCACACAG AGTCAGGGTATGAGGGAGCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 322} {0: 1, 1: 0, 2: 2, 3: 38, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!