ID: 1147285604_1147285619

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1147285604 1147285619
Species Human (GRCh38) Human (GRCh38)
Location 17:39401128-39401150 17:39401161-39401183
Sequence CCCCGCGGGGGCCCGCTGGTGGG GGGCGAACCGGCGAGGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 116} {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!