ID: 1147292014_1147292023

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1147292014 1147292023
Species Human (GRCh38) Human (GRCh38)
Location 17:39451148-39451170 17:39451187-39451209
Sequence CCGGGACGCAGGGCACCAGCAGT AAGGATCAATCTGAAGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 144} {0: 1, 1: 1, 2: 1, 3: 9, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!