ID: 1147302501_1147302505

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147302501 1147302505
Species Human (GRCh38) Human (GRCh38)
Location 17:39541133-39541155 17:39541149-39541171
Sequence CCCTGCTTTCTTCTTCCCATCTA CCATCTACACACAGTTGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 75, 4: 905} {0: 1, 1: 0, 2: 1, 3: 5, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!