ID: 1147312823_1147312828

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1147312823 1147312828
Species Human (GRCh38) Human (GRCh38)
Location 17:39605285-39605307 17:39605307-39605329
Sequence CCACCCACAGGTAACAGGACTGC CGCTGCCCCAGGAGAGCGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 130} {0: 1, 1: 0, 2: 2, 3: 21, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!