ID: 1147322761_1147322776

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1147322761 1147322776
Species Human (GRCh38) Human (GRCh38)
Location 17:39656231-39656253 17:39656284-39656306
Sequence CCAGGGCTCCTGGGCTCCATCGC GTGGCTGGTGCCCCACCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 52, 4: 391} {0: 1, 1: 0, 2: 1, 3: 9, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!