ID: 1147328349_1147328358

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1147328349 1147328358
Species Human (GRCh38) Human (GRCh38)
Location 17:39681124-39681146 17:39681176-39681198
Sequence CCAAAGTGCTGGAACCGCAGGTG TCTTATAAGCAGAAACACAAGGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 309, 3: 7327, 4: 91555} {0: 1, 1: 0, 2: 1, 3: 33, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!