|
Left Crispr |
Right Crispr |
| Crispr ID |
1147331895 |
1147331909 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:39704275-39704297
|
17:39704326-39704348
|
| Sequence |
CCCCCAGGAAATCAACGGGGACC |
AGCACTTTGGGAGGCCGAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 4, 4: 117} |
{0: 5294, 1: 101129, 2: 189241, 3: 132828, 4: 69895} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|