ID: 1147335150_1147335169

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1147335150 1147335169
Species Human (GRCh38) Human (GRCh38)
Location 17:39723272-39723294 17:39723325-39723347
Sequence CCACCCCAAACTAGCCCTCAATC GACGTCCATCATCTCTGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138} {0: 1, 1: 0, 2: 0, 3: 13, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!