ID: 1147338839_1147338848

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1147338839 1147338848
Species Human (GRCh38) Human (GRCh38)
Location 17:39742156-39742178 17:39742201-39742223
Sequence CCAGTTAGAGCAGTGAGGTGCTA AACCGCCGTGTGAGGTCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80} {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!