|
Left Crispr |
Right Crispr |
| Crispr ID |
1147342832 |
1147342838 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:39764802-39764824
|
17:39764846-39764868
|
| Sequence |
CCTCTCCTGTGGGGAGGGGGAGG |
TTTTTTGTGGAAAATATCATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 13, 3: 70, 4: 587} |
{0: 1, 1: 1, 2: 14, 3: 170, 4: 1236} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|