ID: 1147349369_1147349379

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1147349369 1147349379
Species Human (GRCh38) Human (GRCh38)
Location 17:39828177-39828199 17:39828223-39828245
Sequence CCTTTATGTCAGAACTCCTAAGG TTACCCCATCTGGCAAAATTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 10, 4: 89} {0: 1, 1: 5, 2: 16, 3: 27, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!