ID: 1147349374_1147349379

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1147349374 1147349379
Species Human (GRCh38) Human (GRCh38)
Location 17:39828193-39828215 17:39828223-39828245
Sequence CCTAAGGGCCTGATGAGGCAGGC TTACCCCATCTGGCAAAATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 194} {0: 1, 1: 5, 2: 16, 3: 27, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!