ID: 1147359409_1147359417

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147359409 1147359417
Species Human (GRCh38) Human (GRCh38)
Location 17:39921725-39921747 17:39921741-39921763
Sequence CCTGCTTCCCTCCCTGCCCACAT CCCACATCCCAAAGGAGATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 132, 4: 1211} {0: 1, 1: 0, 2: 2, 3: 25, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!