ID: 1147360009_1147360017

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1147360009 1147360017
Species Human (GRCh38) Human (GRCh38)
Location 17:39924528-39924550 17:39924544-39924566
Sequence CCATCCCCCAGCCTCACCCCCTA CCCCCTATGGCACTCCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 271, 4: 2541} {0: 1, 1: 0, 2: 1, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!