ID: 1147374621_1147374637

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1147374621 1147374637
Species Human (GRCh38) Human (GRCh38)
Location 17:40016305-40016327 17:40016354-40016376
Sequence CCCCTGAGCAGCTGCCCCAGCCA AAGGATAAGGCTAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 455} {0: 1, 1: 0, 2: 2, 3: 25, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!