ID: 1147377032_1147377040

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1147377032 1147377040
Species Human (GRCh38) Human (GRCh38)
Location 17:40028672-40028694 17:40028696-40028718
Sequence CCCTTCCTCCAAGATCTCCAGCC GGATGCTCTGCCTAGGCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 456} {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!