ID: 1147377719_1147377725

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1147377719 1147377725
Species Human (GRCh38) Human (GRCh38)
Location 17:40032807-40032829 17:40032821-40032843
Sequence CCGTCACCCTTCTGTGGACTCTG TGGACTCTGAGGATTTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 322} {0: 1, 1: 0, 2: 1, 3: 19, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!