ID: 1147383256_1147383260

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1147383256 1147383260
Species Human (GRCh38) Human (GRCh38)
Location 17:40068061-40068083 17:40068076-40068098
Sequence CCAACTCTAGTTCTCATGGCTGC ATGGCTGCAAAGGTGTCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 165} {0: 1, 1: 0, 2: 0, 3: 19, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!