ID: 1147400573_1147400588

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1147400573 1147400588
Species Human (GRCh38) Human (GRCh38)
Location 17:40178073-40178095 17:40178104-40178126
Sequence CCCCCGCCGAGCCGGGGCTGGAG TGAGGAGGAAGGAGGAGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 227} {0: 1, 1: 0, 2: 16, 3: 217, 4: 1919}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!