ID: 1147421864_1147421876

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1147421864 1147421876
Species Human (GRCh38) Human (GRCh38)
Location 17:40325955-40325977 17:40325992-40326014
Sequence CCTTCTCCCCTCCCTAAATCCAA TGGTTTGTGAAATGAAAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 608} {0: 1, 1: 0, 2: 5, 3: 54, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!