ID: 1147425817_1147425820

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1147425817 1147425820
Species Human (GRCh38) Human (GRCh38)
Location 17:40345424-40345446 17:40345438-40345460
Sequence CCGGCTGATTTCCTGCTGATCTC GCTGATCTCCTCCAGGAAACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 230} {0: 1, 1: 0, 2: 3, 3: 18, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!