ID: 1147440610_1147440619

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1147440610 1147440619
Species Human (GRCh38) Human (GRCh38)
Location 17:40444786-40444808 17:40444818-40444840
Sequence CCGAGAGCTGCAGGAGCCTCATG TAGGGAATAGAGAAGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 312} {0: 1, 1: 1, 2: 0, 3: 38, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!