ID: 1147441258_1147441262

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1147441258 1147441262
Species Human (GRCh38) Human (GRCh38)
Location 17:40448571-40448593 17:40448593-40448615
Sequence CCAGGATGAGTAGCACCAGGTGG GCTGGAACTCTTGTGTGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121} {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!