ID: 1147491366_1147491377

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1147491366 1147491377
Species Human (GRCh38) Human (GRCh38)
Location 17:40870449-40870471 17:40870500-40870522
Sequence CCTCCCCGAAGCTGAGGTTCTTC GCAGTGCCCACTGGGGATTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!