ID: 1147528541_1147528544

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1147528541 1147528544
Species Human (GRCh38) Human (GRCh38)
Location 17:41251020-41251042 17:41251034-41251056
Sequence CCTCAGTGAGAAACAGCTGCGTG AGCTGCGTGATATGGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 170} {0: 1, 1: 1, 2: 1, 3: 7, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!